Update documentation for get_seq which uses 1-based closed intervals

[eroller]

No description provided.

[codecov]

Welcome to Codecov 🎉

Once you merge this PR into your default branch, you're all set! Codecov will compare coverage reports and display results in all future pull requests.

Thanks for integrating Codecov - We've got you covered ☂️

[mdshw5]

Good catch! After reviewing my test data (

pyfaidx/tests/test_feature_bounds_check.py

Lines 67 to 79 in 1075c8e

	def test_fetch_middle(remove_index):
	faidx = Faidx('data/genes.fasta')
	expect = 'TTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACTGTTAAA'
	result = faidx.fetch('gi|557361099|gb|KF435150.1|',
	100, 150)
	assert str(result) == expect
	def test_fetch_end(remove_index):
	faidx = Faidx('data/genes.fasta')
	expect = 'TC'
	result = faidx.fetch('gi|557361099|gb|KF435150.1|',
	480, 481)
	assert str(result) == expect

) I agree that the fetch method uses 1-based indices and is end-inclusive.